.

Virus battery

2009-04-03T13:18:00.003+02:00

For the first time, MIT researchers have shown they can genetically engineer viruses to build both the positively and negatively charged ends of a lithium-ion battery.

The new virus-produced batteries have the same energy capacity and power performance as state-of-the-art rechargeable batteries being considered to power plug-in hybrid cars, and they could also be used to power a range of personal electronic devices, said Angela Belcher, the MIT materials scientist who led the research team.

The new batteries, described in the April 2 online edition of Science, could be manufactured with a cheap and environmentally benign process: The synthesis takes place at and below room temperature and requires no harmful organic solvents, and the materials that go into the battery are non-toxic

Full article

Meat is not murder

2009-03-16T17:45:00.002+01:00

Hot topic, since Clooney's being made into tofu. In vitro meat is a very near future thing, and why not. Food fabrication is already happening with breeding and industrialization of the animals anyway. If you had a burger that came out of a printer, or was grown in a tissue culture farm, would you notice the difference?

Also bones are being printed

Muscle and bone tissue out of an inkjet

Hydrogel or "bio-paper"

Main article on bio-printers

Project brief pt.2

2009-03-16T15:29:00.003+01:00

Additional part to the brief:

Biological devices are here. They living organisms that are purpose-built to handle a task, that otherwise would be difficult, waste a lot of resources or a method for handling them has not yet been created.

My focus is to bring these devices into everyday life of a regular human being. I will investigate the possibilities of using biology as a domestic appliance, sort of like an invisible maid, that cleans, cooks, takes care and entertains. The science is looking at the new biology as a purely medical device, to cure humanity in ways that were not possible. This project is about re-imagining the ways we can use the technology in our everyday lives.

The reason for using wetware as material, is its sustainability, adaptibility/ability to repurpose itself and the fact that it dies.

Concept video 1

2009-03-16T15:15:00.003+01:00

First concept video sketch, which is a really quick one and really wouldn't work, but it outlines the core ideas; the protocol, application and the interface(s). No outcome yet.

BioDevice - Music Player from susufasu on Vimeo.

Food from George Clooney's sweat

2009-03-13T15:27:00.004+01:00

Seriously, PETA wants to create tofu that is flavoured with George Clooney's sweat and they call it CloFu. "CloFu could make your taste buds and your heart melt. Of course, what's even better is that after everyone gets a piece of George and realizes how delicious tofu truly is, diets will be revolutionized.", says the PETA blogger Liz Graffeo.

Great! I'm actually happy about this. Food is one of the areas where biotech can be a real future player, not just making GM crops or hybrid fruits like grapples, pluots, lematos or tangelos.

Finally some clarity

2009-03-12T18:55:00.003+01:00

After figuring out a few scenarios, I ripped them apart and figured out the key essentials to make the project work. The flowchart is like this:

PROTOCOL (done) ---> APPLICATIONS (in progress) ---> INTERFACE (in progress) ---> OUTCOME (not started yet).

Protocol is essential, so my first task was designing it, having done that some internal brainstorming was required to kickoff the next part; how to implement the protocol to applications and their interfaces. Because neutrality is one of my key goals in at least few scenarios, the outcome will result from the design of the applications.

Man turned into a USB stick

2009-03-10T16:45:00.002+01:00

My initial idea was to turn, the human body into a USB stick, but this finnish hacker already beat me to it. He lost his finger in a motorcycle accident and replaced it with a prostetic finger that has a built in USB memory stick, including a USB bootable Linux-distro and the movie Freddy Got Fingered.

Sometimes truth is stranger than fiction.

MIT DiyBio video

2009-03-08T23:09:00.006+01:00

I got the inspiration to get the biotech kit from this video.

http://mitworld.mit.edu/video/646

It ends with a discussion on what to do with biotech.

Biotech kits

2009-03-08T22:30:00.002+01:00

I just ordered my own biotech kit. It's basically an educational toy, but I need some hands-on stuff, to see how things work now. Later I might order, if the need arises, a bit more serious kit from these guys.

Also this might be an interesting 'toy'. Really expensive, though, but ebay sells it for $30.

Here is mine.

Bio-art 2

2009-03-08T19:55:00.002+01:00

ProM - Music composing software that interprets amino acid sequences in to notes and plays the music

Biology as art at Grinnell - Marta de Menezes' course at Grinnell. Students using biotech to create art.

Ectopia - Artist residency program in Portugal. Using biology as medium.

Time to update

2009-03-01T22:39:00.002+01:00

So, the last month spent on reading books and cambridging. The result? Way too much knowledge. I've concluded that transhumanist are the worst sort of people to get any information on biotech and it's applications. I'm going to a different direction and try to make extreme examples of everyday HCI applications to work with biology. Here is my inspiration. I'll update more on transhumanism and the technical aspects of DNA next.

From Monty Python.

Design and biology

2009-01-29T19:36:00.007+01:00

So far, during my research I have found very few applications that look biology and IT from a design eye. The DNA tattoo mentioned below, Microsoft's human body as network bus and.. the rest is very hypothetical, artistic or medical. Why is this? This type of interaction is the most natural way. Our skin is conductive, our cells store memories, information can be exchanged by touching other humans only. Are we designers locked into the present and can't imagine the world without technology? Or are we just waiting for the right tools to arrive? Or..?

Update: Well, how about that; Storing data encoded DNA in living organisms has been patented.

Update2: Also the japanese are at it. This is a better article to read than a patent application, though.

Great, this is exactly what I was looking for. All I need now is a confirmation that this data can be transferred on to other humans/machines, which I'm pretty sure can be done. Now how to design around that concept is an intriguing question. Will it make devices that store memory obsolete? Are people designing USB stick about to lose their jobs? What kind of things we need to decode this information?

Applications

2009-01-28T14:37:00.002+01:00

Mostly the ideas in biotech revolve around medical applications. However, now things are starting to surface where biotech is used for other things as well, like this DNA tattoo. The possibilities are limitless. Living packaging materials, which mimick nature. Materials that live can grow or die. Biology is sustainable as well, natural (modified) materials compose and leave no waste behind. At the moment the source material to create DNA is extracted from sugar and printed out with system that vaguely reminds a standard 4-color inkjet printer.

BioBricks

2009-01-28T13:02:00.004+01:00

Creating biological "machines" is hard. Basically DNA is a bunch A's, T's, G's and C's. A string of DNA probably would look something like this: ACTGACTCGCCGATACCGAACTGACATGGCTCAGACTATCTCTATTCTCATGTAGTGGAGATCTACTGCTA.

No one, without a lot of patience, a clear goal and years of education, would be able reverse engineer that, take the part that is necessary and then repurpose it in to another string that looks almost the same. The BioBricks Foundation is trying to make it easier, by creating small parts that each have their own purpose and can be linked together to form a compound. The parts registry is completely open source and can be viewed here. So the tools exsist, but their understanding is not complete.

Here is short summary by Drew Endy on Wired. For the full hour presentation look at the first post.

Biotech art projects

2009-01-26T16:14:00.002+01:00

(Critical Art Ensemble) -free books and and art projects related to biotech

(Ars Synthetica) - Links and discussions revolving around synthetic biology (Very good!)

Molecular Automatas and DNA Logic Gates

2009-01-26T14:37:00.007+01:00

Logic gates on a molecular automata playing tic-tac-toe. (Check links)

DNA logic gates work the same way as computer ones. If an input is given to the DNA-computer, it checks whether this input is valid or not (YES or NOT-gate), or should another input be given (AND-gate) and so on. (Logic gates on Wikipedia) (Molecular computing group in New Mexico)

DNA computers on:

(How Stuff Works)

(National Geographic)

(vxm)

(Lego logic gates)

DIYbio and biohacking

2009-01-21T16:39:00.003+01:00

(DIYbio) is an organization that aims to help make biology a worthwhile pursuit for citizen scientists, amateur biologists, and DIY biological engineers who value openness and safety.

News on DIYbio.

Drew Endy is one of the leading figures in synthetic biology. Talk from 24C3.

Designing Biology

2009-01-21T16:04:00.000+01:00

This is my blog for my MA Interaction Design thesis for Umeå Institute of Design. It is related to the field of biotechnology and how designers can in the future be able to design "biological machines", what kind of interactions these machines can produce and what kind technology and interfaces are required to this.